ID: 979475533_979475538

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 979475533 979475538
Species Human (GRCh38) Human (GRCh38)
Location 4:121152857-121152879 4:121152873-121152895
Sequence CCTGGCCACTGTGCCTCTGGTGC CTGGTGCCTAATGGAGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 294} {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!