ID: 979480294_979480295

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 979480294 979480295
Species Human (GRCh38) Human (GRCh38)
Location 4:121208683-121208705 4:121208717-121208739
Sequence CCATTGGGCTGTTAAAAGTGGGT AAAAATACATTCTTTGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 111} {0: 1, 1: 0, 2: 1, 3: 48, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!