ID: 979492003_979492015

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 979492003 979492015
Species Human (GRCh38) Human (GRCh38)
Location 4:121338892-121338914 4:121338942-121338964
Sequence CCCCTCCTCCATGTAATCCTTTC GTTTTCAGGAGTTCTGATGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 307} {0: 1, 1: 0, 2: 2, 3: 26, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!