ID: 979495646_979495654

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 979495646 979495654
Species Human (GRCh38) Human (GRCh38)
Location 4:121380012-121380034 4:121380032-121380054
Sequence CCAACCTATGTCTCTAAGCCACA ACAAGGAGGAAGCACTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!