ID: 979495796_979495806

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 979495796 979495806
Species Human (GRCh38) Human (GRCh38)
Location 4:121380933-121380955 4:121380962-121380984
Sequence CCCTAAGGCGAGGCGCCGCCACG GGTGCTGGAGCGCCACGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17} {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!