ID: 979535028_979535033

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 979535028 979535033
Species Human (GRCh38) Human (GRCh38)
Location 4:121809906-121809928 4:121809958-121809980
Sequence CCCAAGAAATGGTAAGCATTCGG TCATTTCAGAACATATTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106} {0: 1, 1: 0, 2: 2, 3: 45, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!