ID: 979536194_979536199

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 979536194 979536199
Species Human (GRCh38) Human (GRCh38)
Location 4:121823451-121823473 4:121823469-121823491
Sequence CCCGCGGGTTCCCGGACTTCAGT TCAGTACCGCCAGCGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76} {0: 1, 1: 0, 2: 0, 3: 5, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!