ID: 979547258_979547273

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 979547258 979547273
Species Human (GRCh38) Human (GRCh38)
Location 4:121951918-121951940 4:121951969-121951991
Sequence CCGTGGCTGCGACGAGGAAGCCC GAGGCTCTCCAGCCCCGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!