ID: 979561913_979561919

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 979561913 979561919
Species Human (GRCh38) Human (GRCh38)
Location 4:122110377-122110399 4:122110428-122110450
Sequence CCGAATACTGCGCTGTTCCGACC ATATCCCACACCTGGCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 44, 2: 606, 3: 1631, 4: 1740} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!