ID: 979563388_979563391

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 979563388 979563391
Species Human (GRCh38) Human (GRCh38)
Location 4:122125614-122125636 4:122125653-122125675
Sequence CCTATGTCCATTTGTATATTTGT CTATTTTTAAGGTGCCTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 536} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!