ID: 979567619_979567628

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 979567619 979567628
Species Human (GRCh38) Human (GRCh38)
Location 4:122173302-122173324 4:122173347-122173369
Sequence CCAAGTTGAGGGGGTGCATCTGG GACTCTGCAGAGTCTTGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 129} {0: 1, 1: 26, 2: 34, 3: 115, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!