ID: 979582768_979582772

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 979582768 979582772
Species Human (GRCh38) Human (GRCh38)
Location 4:122379544-122379566 4:122379560-122379582
Sequence CCTCGCGCAGAGCGGCCTGAAGC CTGAAGCGAGAGGTTGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71} {0: 1, 1: 0, 2: 2, 3: 33, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!