ID: 979610519_979610528

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 979610519 979610528
Species Human (GRCh38) Human (GRCh38)
Location 4:122684226-122684248 4:122684257-122684279
Sequence CCCCCCTACCAGGGTTTGGCTTT TAGTTGGCCTCTCTTTGCCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 34, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!