ID: 979649463_979649467

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 979649463 979649467
Species Human (GRCh38) Human (GRCh38)
Location 4:123113993-123114015 4:123114032-123114054
Sequence CCTCTCTGCTGCTGGTCATCCTG GCAGAGAGGAGGCCCTGAAGAGG
Strand - +
Off-target summary {0: 2, 1: 40, 2: 88, 3: 227, 4: 607} {0: 8, 1: 136, 2: 252, 3: 288, 4: 657}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!