ID: 979656850_979656854

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 979656850 979656854
Species Human (GRCh38) Human (GRCh38)
Location 4:123205264-123205286 4:123205309-123205331
Sequence CCATACATTTCAGAATCAGATAG ATTTAGTAGCTGTATGAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 197} {0: 1, 1: 0, 2: 7, 3: 78, 4: 702}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!