|
Left Crispr |
Right Crispr |
| Crispr ID |
979662940 |
979662944 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:123279271-123279293
|
4:123279291-123279313
|
| Sequence |
CCGGGCGTGGTGGCAGGCACCTG |
CTGTAATCCCAGCTGAGGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2562, 1: 16195, 2: 47269, 3: 85378, 4: 123123} |
{0: 3, 1: 11, 2: 26, 3: 87, 4: 531} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|