ID: 979674865_979674874

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 979674865 979674874
Species Human (GRCh38) Human (GRCh38)
Location 4:123399014-123399036 4:123399066-123399088
Sequence CCGCAACTTTCTTCTGGTTTGGA GGCACTGCCACTTTAAAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 326, 4: 6728} {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!