ID: 979783202_979783204

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 979783202 979783204
Species Human (GRCh38) Human (GRCh38)
Location 4:124682036-124682058 4:124682055-124682077
Sequence CCTAGCAAATGCTGTGTATGCAC GCACTTAAAAAGAATGCACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 123} {0: 1, 1: 1, 2: 0, 3: 31, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!