ID: 979821977_979821980

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 979821977 979821980
Species Human (GRCh38) Human (GRCh38)
Location 4:125186186-125186208 4:125186222-125186244
Sequence CCAATAAAAACAATTAACTATCT GACTGAAGGTAGATGGTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 420} {0: 1, 1: 1, 2: 2, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!