ID: 979932064_979932068

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 979932064 979932068
Species Human (GRCh38) Human (GRCh38)
Location 4:126643195-126643217 4:126643210-126643232
Sequence CCAAAAAAGGAAATAATGGAGGA ATGGAGGAGCAGAGGGATGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 122, 4: 1050}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!