ID: 979972530_979972541

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 979972530 979972541
Species Human (GRCh38) Human (GRCh38)
Location 4:127154770-127154792 4:127154806-127154828
Sequence CCCCAACACAGTGTCCCCATTCT CTGCACAGGAGGTGAGCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 17, 3: 56, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!