ID: 979977472_979977482

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 979977472 979977482
Species Human (GRCh38) Human (GRCh38)
Location 4:127214447-127214469 4:127214487-127214509
Sequence CCAGGCAGGAGGGTTAGGGAAAA ACTGCAAGGGAAGAAAGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!