ID: 980002263_980002265

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 980002263 980002265
Species Human (GRCh38) Human (GRCh38)
Location 4:127503708-127503730 4:127503729-127503751
Sequence CCTTCTTTTATCTGTTTTAACAC ACAGCTCAATATTATGGAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 506} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!