ID: 980019438_980019447 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 980019438 | 980019447 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:127690972-127690994 | 4:127691014-127691036 |
| Sequence | CCCCAGAAATCCTCTGTGTTCTG | CCTCCCTTTCCATTAACCCCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 3, 2: 41, 3: 252, 4: 693} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||