ID: 980029562_980029564

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 980029562 980029564
Species Human (GRCh38) Human (GRCh38)
Location 4:127811516-127811538 4:127811550-127811572
Sequence CCATGGAATCTTCAGTGTGGCTA ATTGAGAAGCAAAATTTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 167} {0: 1, 1: 0, 2: 2, 3: 37, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!