ID: 980037236_980037240

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 980037236 980037240
Species Human (GRCh38) Human (GRCh38)
Location 4:127899433-127899455 4:127899479-127899501
Sequence CCTAGGTCCATGTGTTTTTGTGG AGAGTCTCACTCTGTCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 379} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!