ID: 980053816_980053831

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 980053816 980053831
Species Human (GRCh38) Human (GRCh38)
Location 4:128061612-128061634 4:128061651-128061673
Sequence CCGGTGTCCCGGCGGAGAGACGG GCCTCGGGGCCACCCCGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 18, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!