ID: 980058528_980058531

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 980058528 980058531
Species Human (GRCh38) Human (GRCh38)
Location 4:128103422-128103444 4:128103436-128103458
Sequence CCACCAACAATGAATGAATTACC TGAATTACCTGCCTTGGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 358} {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!