ID: 980066209_980066211

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 980066209 980066211
Species Human (GRCh38) Human (GRCh38)
Location 4:128191628-128191650 4:128191644-128191666
Sequence CCTACAGTGTGGTCCTGCTGAAC GCTGAACAGCCACTCTGATATGG
Strand - +
Off-target summary No data {0: 1, 1: 24, 2: 71, 3: 65, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!