ID: 980066209_980066213

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 980066209 980066213
Species Human (GRCh38) Human (GRCh38)
Location 4:128191628-128191650 4:128191656-128191678
Sequence CCTACAGTGTGGTCCTGCTGAAC CTCTGATATGGCATCTCTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 33, 3: 58, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!