ID: 980102227_980102236

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 980102227 980102236
Species Human (GRCh38) Human (GRCh38)
Location 4:128553181-128553203 4:128553203-128553225
Sequence CCTCCGGAGCTCTCCTCCCGGGG GGGGAGAGCAGCTCCTCTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128} {0: 1, 1: 0, 2: 1, 3: 18, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!