ID: 980130035_980130048

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 980130035 980130048
Species Human (GRCh38) Human (GRCh38)
Location 4:128809865-128809887 4:128809890-128809912
Sequence CCCTCCGCAGCAGGTACGCGCGC GCCGCGGGGGGCGCGCGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} {0: 1, 1: 2, 2: 14, 3: 163, 4: 1169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!