ID: 980130035_980130050

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 980130035 980130050
Species Human (GRCh38) Human (GRCh38)
Location 4:128809865-128809887 4:128809891-128809913
Sequence CCCTCCGCAGCAGGTACGCGCGC CCGCGGGGGGCGCGCGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} {0: 1, 1: 1, 2: 8, 3: 66, 4: 514}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!