ID: 980162129_980162131

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 980162129 980162131
Species Human (GRCh38) Human (GRCh38)
Location 4:129177539-129177561 4:129177552-129177574
Sequence CCTTTATTCAATACTGCATGAAG CTGCATGAAGAGATTGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 182} {0: 1, 1: 0, 2: 3, 3: 21, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!