ID: 980246953_980246959

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 980246953 980246959
Species Human (GRCh38) Human (GRCh38)
Location 4:130258553-130258575 4:130258575-130258597
Sequence CCTACCTGTGACCTAGAAGCCCC CTTCCCTGCTTGAATTGTCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!