ID: 980288113_980288116

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 980288113 980288116
Species Human (GRCh38) Human (GRCh38)
Location 4:130807174-130807196 4:130807206-130807228
Sequence CCATAAATCTTGAACAAATTTCC TATTTGGATTTTTAACTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 330} {0: 2, 1: 0, 2: 10, 3: 92, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!