ID: 980302767_980302774 |
View in Genome Browser |
Spacer: 8 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 980302767 | 980302774 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:131015023-131015045 | 4:131015054-131015076 |
Sequence | CCTTTTCCTCCTGGCTGGCTCGT | GCAAATGGTGGAGGGTGTCTAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |