ID: 980363845_980363849

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 980363845 980363849
Species Human (GRCh38) Human (GRCh38)
Location 4:131773294-131773316 4:131773340-131773362
Sequence CCCAGCACCGGTAATGAGCTTGT TATCACTTTAACGCAGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 39} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!