ID: 980368081_980368090

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 980368081 980368090
Species Human (GRCh38) Human (GRCh38)
Location 4:131832370-131832392 4:131832421-131832443
Sequence CCTGCTGTGTTCCACACCTTGCA GGAGCCAGGAAGAGAGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 31, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!