ID: 980384498_980384503

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 980384498 980384503
Species Human (GRCh38) Human (GRCh38)
Location 4:132069712-132069734 4:132069743-132069765
Sequence CCTCCGTCTCCTGGATTCAAGTG TCTTCAGCCTCCCGAGTAGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 145, 2: 6590, 3: 129012, 4: 314656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!