ID: 980389416_980389420

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 980389416 980389420
Species Human (GRCh38) Human (GRCh38)
Location 4:132123850-132123872 4:132123875-132123897
Sequence CCCAAAGCCTGTTTGGTGGTCTC CACAAGGACGCCCATGAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 24, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!