ID: 980420687_980420692

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 980420687 980420692
Species Human (GRCh38) Human (GRCh38)
Location 4:132556295-132556317 4:132556322-132556344
Sequence CCTTTGAAAGAGAAGTTCACCGC CTGTGTGAGGGGAAAGTGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!