ID: 980524816_980524832

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 980524816 980524832
Species Human (GRCh38) Human (GRCh38)
Location 4:133976103-133976125 4:133976156-133976178
Sequence CCCCTGCCACCTTCCCCCAACAG TCCATATGTTCTCATTGTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!