ID: 980524821_980524828

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 980524821 980524828
Species Human (GRCh38) Human (GRCh38)
Location 4:133976116-133976138 4:133976133-133976155
Sequence CCCCCAACAGAGCCCAGTTTGTG TTTGTGTTGTTCCTCTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 57, 3: 1099, 4: 5237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!