ID: 980691450_980691457 |
View in Genome Browser |
Spacer: 20 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 980691450 | 980691457 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 4:136300151-136300173 | 4:136300194-136300216 |
| Sequence | CCCCTGTGCTCTCTGTTCTCTGC | CATTCTGAGCATAGGGAGCCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 7, 3: 75, 4: 692} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||