ID: 980694539_980694545

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 980694539 980694545
Species Human (GRCh38) Human (GRCh38)
Location 4:136337789-136337811 4:136337813-136337835
Sequence CCTGGGCCAACTGTACCAATTGG AGCAGATCCACATTTCTCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!