ID: 980731963_980731968

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 980731963 980731968
Species Human (GRCh38) Human (GRCh38)
Location 4:136835452-136835474 4:136835479-136835501
Sequence CCCCAAAATTCATATGCTGAAAT ACCCACAAAGTGATGGTAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 62, 3: 441, 4: 1436}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!