ID: 980790429_980790439

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 980790429 980790439
Species Human (GRCh38) Human (GRCh38)
Location 4:137613267-137613289 4:137613314-137613336
Sequence CCATCCACCACTGCTGCTTGACG CCATCCCTGCGGATCCTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!