ID: 980823691_980823695

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 980823691 980823695
Species Human (GRCh38) Human (GRCh38)
Location 4:138048473-138048495 4:138048509-138048531
Sequence CCACAGCAAAGAGGAAGCTTGGG GACCTCCACCCTAAGTATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 250} {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!