ID: 980864352_980864357

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 980864352 980864357
Species Human (GRCh38) Human (GRCh38)
Location 4:138536907-138536929 4:138536926-138536948
Sequence CCAATTAAACCACTACAGCCATT CATTATGGACAATGGTATGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 22, 3: 172, 4: 852}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!